Review



dynabeads human t expander cd3 cd28  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Thermo Fisher dynabeads human t expander cd3 cd28
    Dynabeads Human T Expander Cd3 Cd28, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/Protamine+sulfate/pm41920992-285-5-10
    Average 95 stars, based on 1 article reviews
    dynabeads human t expander cd3 cd28 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Activation Assay:

    Article Title: Modulating the polyamine/hypusine axis controls generation of CD8 + tissue-resident memory T cells
    Article Snippet: Human CD8 + T cells were isolated using negative immunomagnetic selection (Miltenyi Biotec, 130-096-495) and were cultured in RPMI 1640 media supplemented with 10% FBS and 100 U/mL pen/strep, cultured in 96-well plates at a seeding concentration of 2 × 10 5 cells per well. .. Activation was performed using CD3/CD28 Dynabeads (Dynabeads Human T-Activator CD3/CD28, Thermo Fisher Scientific, 11131D) at 1:1 bead/cell ratio in the presence of 10 ng/mL IL-2 (PeproTech, 200-02). .. Second-generation CAR constructs were synthesized and cloned into the pMXs (Cell Biolabs) retroviral vector from Genewiz (Azenta Life Sciences).

    other:

    Article Title: Modulating the polyamine/hypusine axis controls generation of CD8 + tissue-resident memory T cells
    Article Snippet: Cells were activated using CD3/CD28 Dynabeads (Dynabeads Human T-Activator CD3/CD28, Thermo Fisher Scientific, 11131D) at a 1:1 bead/cell ratio.

    Cell Culture:

    Article Title: Immune cells having co-expressed shRNAS and logic gate systems
    Article Snippet: T Cell Engineering for Dual shRNA Knockdown T-cells were enriched from peripheral blood mononuclear cells (PBMCs) obtained from normal donor Leukopaks (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and the EasySep Human T-Cell Isolation Kit (STEMCELL Technologies). .. T-cells were subsequently activated with CD3/CD28 Dynabeads at 1:1 bead to cell ratio (ThermoFisher, 40203D) in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade) and cultured at 37° C., 5% CO2 for 48 hours before electroporation. .. CRISPR RNP were prepared by combining 120 μM sgRNA (Synthego) targeting DNA sequence GAGCCATGCTTGGCTTACGA (GS94, SEQ ID NO: 307), 62.5 μM sNLS-SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) at a volume ratio of 5:1:3:6, and incubated for 15 minutes at room temperature.

    Article Title: A dual-targeting approach with anti-IL10R CAR-T cells engineered to release anti-CD33 bispecific antibody in enhancing killing effect on acute myeloid leukemia cells
    Article Snippet: BsAb-T Cell Human CD3+ T-cells were isolated from healthy donors from Tianjin Blood Center using the human T Cells Enrichment Cocktail (STEMCELL, USA) following the manufacturer’s protocol. .. To generate CAR.BsAb-T cells, T-cells were activated on day 0 using CD3/CD28 Dynabeads (#11131D, Gibco, ) and cultured in lymphocyte medium KBM581 (Corning, USA) supplemented with 5% FBS and 50 IU/mL recombinant human IL-2 (Cat.# 200IL-500, RD Systems, USA). ..

    Electroporation:

    Article Title: Immune cells having co-expressed shRNAS and logic gate systems
    Article Snippet: T Cell Engineering for Dual shRNA Knockdown T-cells were enriched from peripheral blood mononuclear cells (PBMCs) obtained from normal donor Leukopaks (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and the EasySep Human T-Cell Isolation Kit (STEMCELL Technologies). .. T-cells were subsequently activated with CD3/CD28 Dynabeads at 1:1 bead to cell ratio (ThermoFisher, 40203D) in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade) and cultured at 37° C., 5% CO2 for 48 hours before electroporation. .. CRISPR RNP were prepared by combining 120 μM sgRNA (Synthego) targeting DNA sequence GAGCCATGCTTGGCTTACGA (GS94, SEQ ID NO: 307), 62.5 μM sNLS-SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) at a volume ratio of 5:1:3:6, and incubated for 15 minutes at room temperature.

    Construct:

    Article Title: De novo -designed minibinders expand the synthetic biology sensing repertoire
    Article Snippet: .. For each construct tested, 1e6 Primary T cells were thawed and activated the next day using CD3/CD28 Dynabeads (Life Technologies #11131D) at a 1:3 cell: bead ratio. ..

    Recombinant:

    Article Title: A dual-targeting approach with anti-IL10R CAR-T cells engineered to release anti-CD33 bispecific antibody in enhancing killing effect on acute myeloid leukemia cells
    Article Snippet: BsAb-T Cell Human CD3+ T-cells were isolated from healthy donors from Tianjin Blood Center using the human T Cells Enrichment Cocktail (STEMCELL, USA) following the manufacturer’s protocol. .. To generate CAR.BsAb-T cells, T-cells were activated on day 0 using CD3/CD28 Dynabeads (#11131D, Gibco, ) and cultured in lymphocyte medium KBM581 (Corning, USA) supplemented with 5% FBS and 50 IU/mL recombinant human IL-2 (Cat.# 200IL-500, RD Systems, USA). ..

    Suspension:

    Article Title: Clinical Staphylococcus aureus inhibits human T-cell activity through interaction with the PD-1 receptor.
    Article Snippet: .. Cells were treated with 50 μL UV-SA/mL cell suspension, PBS (untreated control), or 25 μL/mL prewashed CD3/CD28 dynabeads (Gibco, 11132D) and incubated at 37°C, 5% CO2 for indicated times. ..

    Control:

    Article Title: Clinical Staphylococcus aureus inhibits human T-cell activity through interaction with the PD-1 receptor.
    Article Snippet: .. Cells were treated with 50 μL UV-SA/mL cell suspension, PBS (untreated control), or 25 μL/mL prewashed CD3/CD28 dynabeads (Gibco, 11132D) and incubated at 37°C, 5% CO2 for indicated times. ..

    Incubation:

    Article Title: Clinical Staphylococcus aureus inhibits human T-cell activity through interaction with the PD-1 receptor.
    Article Snippet: .. Cells were treated with 50 μL UV-SA/mL cell suspension, PBS (untreated control), or 25 μL/mL prewashed CD3/CD28 dynabeads (Gibco, 11132D) and incubated at 37°C, 5% CO2 for indicated times. ..

    Derivative Assay:

    Article Title: Mutation-specific CAR T cells as precision therapy for IGLV3-21 R110 expressing high-risk chronic lymphocytic leukemia
    Article Snippet: .. T cells derived from PBMCs of patient CLL425 were activated with CD3/CD28 dynabeads (Life Technologies, Carlsbad, USA, #11131D) and IL-2 (Company, Article#, concentration) for 3 days. ..

    Concentration Assay:

    Article Title: Mutation-specific CAR T cells as precision therapy for IGLV3-21 R110 expressing high-risk chronic lymphocytic leukemia
    Article Snippet: .. T cells derived from PBMCs of patient CLL425 were activated with CD3/CD28 dynabeads (Life Technologies, Carlsbad, USA, #11131D) and IL-2 (Company, Article#, concentration) for 3 days. ..



    Similar Products

    97
    Miltenyi Biotec cd3 cd28 dynabeads
    Cd3 Cd28 Dynabeads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/T+Cell+Activation%2FExpansion+Kit%2C+mouse/pm42134322-272-9-11
    Average 97 stars, based on 1 article reviews
    cd3 cd28 dynabeads - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    95
    Thermo Fisher dynabeads human t expander cd3 cd28
    Dynabeads Human T Expander Cd3 Cd28, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/Protamine+sulfate/pm41920992-285-5-10
    Average 95 stars, based on 1 article reviews
    dynabeads human t expander cd3 cd28 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    86
    Veritas Corporation dynabeads mouse t activator cd3 cd28
    Dynabeads Mouse T Activator Cd3 Cd28, supplied by Veritas Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/activator+cd28+cd3+dynabeads+mouse+t/pm42120415-826-23-27
    Average 86 stars, based on 1 article reviews
    dynabeads mouse t activator cd3 cd28 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Veritas Corporation dynabeads mouse tactivator cd3 cd28
    Dynabeads Mouse Tactivator Cd3 Cd28, supplied by Veritas Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/activator+cd28+cd3+dynabeads+mouse+t/pm42120415-790-24-28
    Average 86 stars, based on 1 article reviews
    dynabeads mouse tactivator cd3 cd28 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Fisher Scientific cd3 cd28 dynabeads
    Cd3 Cd28 Dynabeads, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/buffer+factor+foxp3+set+staining+transcription/pm42106562-413-13-21
    Average 86 stars, based on 1 article reviews
    cd3 cd28 dynabeads - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Fisher Scientific anti cd3 cd28 dynabeads
    Anti Cd3 Cd28 Dynabeads, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/buffer+factor+foxp3+set+staining+transcription/pm42029068-44-25-45
    Average 86 stars, based on 1 article reviews
    anti cd3 cd28 dynabeads - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Miltenyi Biotec cts dynabeads cd3 cd28
    Cts Dynabeads Cd3 Cd28, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/CD3%CE%B5+Antibody%2C+anti-mouse%2C+REAfinity/bio_rxiv__64898__2026__04__09__717505-139-15-29
    Average 99 stars, based on 1 article reviews
    cts dynabeads cd3 cd28 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Miltenyi Biotec dynabeads human t expander cd3 cd28
    a , Activated T cells were treated with either AAV6 or AAV-hT7 carrying a GFP transcript for transient expression. The cells were cultured in either serum free media (SF) or media supplemented with 10% fetal bovine serum (FBS) or human serum (HS) and GFP expression was measured by flow cytometry. Plotted values are GFP + cells relative to the SF value in each MOI condition in order to highlight changes in transduction efficiency when serum is present. Results are the mean ± SEM from three donors (n = 3). Significance was assessed using two-way ANOVA and Dunnett’s multiple comparisons test. b , Activated T cells were treated with either AAV6 or AAV-hT7 carrying a GFP transcript for transient expression at three different MOI. The cells were cultured in either serum free media. These values are used to calculate the relative GFP expression in (Fig. ). Results are the mean from two donors (n = 2). c , Activated T cells from three donors were electroporated with an RNP targeting the TRAC locus and treated with either AAV6 or AAV-hT7 carrying an HDR template to knock in a CAR at TRAC . The cells were cultured in either serum free media. These values are used to calculate the relative GFP expression in (Fig. ). Results are the mean ± SEM from three donors (n = 3). Significance was assessed using multiple two-tailed unpaired t -tests and the Holm-Šidák multiple comparisons test. d , TRAC -CAR-T cells expressing a 1928z-1XX were generated with a combination of EDV and AAV and functionally validated. TRAC -CAR-T cells were co-culture NALM6 cells at three effector cells to tumour cell ratios (E:T) for 24 h. Cytotoxicity was calculated by a luminescence read-out. Results are the mean ± SEM from four technical replicates (n = 4). e , Schematic of a genome-wide knockout screen to identify genes associated with AAV-hT7 uptake and processing in primary T cells. T cells were isolated from PBMCs, activated <t>with</t> <t>CD3/CD28</t> beads, and transduced with the lentiviral sgRNA library, followed by Cas9 electroporation (SLICE approach). 3 days later, T cells were re-activated for 48 h and transduced with AAV6 or AAV-hT7 expressing GFP. At 48 h after AAV-hT7 transduction cells were sorted into four bins based on GFP expression. Genomic DNA was extracted from cells in each bin, and amplicon libraries were prepared and sequenced to determine sgRNA enrichment. f , g , Volcano plot displaying genome-wide KO screen results for AAV6 ( f) and AAV-hT7 ( g ), p-values determined using MAGeCK RRA one-sided tests and methods. h , PBMC-humanized were injected with either AAV6 (n = 6) or AAV-hT7 (n = 6) carrying a ss-CAG-GFP cargo, or PBS (n = 3). DNA was isolated from different organs harvested one week after injection. Viral genomes were quantified through qPCR and normalized by the DNA input. Results are the mean ± SEM.
    Dynabeads Human T Expander Cd3 Cd28, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/CD3%CE%B5+Antibody%2C+anti-mouse%2C+REAfinity/pmc13083257-302-20-52
    Average 99 stars, based on 1 article reviews
    dynabeads human t expander cd3 cd28 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Miltenyi Biotec human t activator cd3 cd28 dynabeads
    ( A and B ) CD25 + percentages from CB and AB naive CD4 + T cells after 96 hours of <t>anti-CD3/CD28</t> stimulation under No Cytokine or IL-2 + TGF-β conditions. ( C – E ) Marker expression on CD25 + fraction by flow cytometry. ( F and G ) ELISA of cytokines in supernatant. ( H ) Allogeneic MLR measuring suppressive capacity of CB and AB No Cytokine and IL-2 + TGF-β-stimulated cells. ( I ) Allogeneic MLR assay for CD25 + versus CD25 neg iTreg-stimulated cells. ( J – L ) FOXP3 CNS2 methylation was assessed by bisulfide sequencing in CD4 + CD25 + CD127 lo cells from iTreg cultures and endogenous blood Tregs (CD4 + FOXP3 + CD25 + CD127 lo ). Two separate experiments were analyzed together with adjustment for batch effects. ( J ) Heatmap, ( K ) violin plot, and ( L ) graphs of CpG island methylation ratios. ( M ) FOXP3 stability assessed through 2 rounds of stimulation and rest. CD25 + and FOXP3 MFI on CD25 + cells after second rest. Data points represent individual donors. ( H and I ) N = 5/group. ( A – E ) One of 3 representative experiments. ( H ) One of 2 representative experiments. ( F , G , I , and M ) Performed once. ( J – L ) Combined data from 2 experiments. ( B – G and M ) Two-way ANOVA with multiple comparisons used. ( I ) One-way ANOVA with multiple comparisons used. ( L ) Linear mixed model (included batch correction). * P ≤ 0.05, ** P ≤ 0.02, *** P ≤ 0.001, **** P < 0.0001. Horizontal bars and column heights in panels B – G and M depict mean values. In H and I , mean value plus standard deviation is shown.
    Human T Activator Cd3 Cd28 Dynabeads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/CD3%CE%B5+Antibody%2C+anti-mouse%2C+REAfinity/pmc13078883-238-9-25
    Average 99 stars, based on 1 article reviews
    human t activator cd3 cd28 dynabeads - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Fisher Scientific cd3 cd28 t activator dynabeads
    A. Schematic representation of the CAR construct used in this study: a second-generation CAR receptor containing a <t>CD28</t> hinge and transmembrane domain, a CD28 costimulatory domain, and CD3ζ signaling domain. B. Schematic representation of the protocol used to manufacture CAR-T cells. Healthy donor-derived PBMCs were activated using an <t>anti-CD3</t> antibody. After 48h, expanded T cells were transduced with a retroviral vector to induce expression of the CAR. Transduction efficiency was assessed 5-7 days after transduction and cells were used for functional analysis between 7-14 days after transduction. C. Schematic representation of the protocol used to detect phosphorylation in CAR-T cells. CAR-T cells were cocultured with PSCA-expressing HPAC (HPAC WT ) or PSCA-deficient HPAC (HPAC PSCA-KO ) tumor cells for 1, 10, 30 and 60 minutes, followed by protein extraction. For cytoplasmic proteins (ZAP70, PLCγ, VAV1), phosphorylation was detected in the whole cell extract (WCE). For detection of phosphorylated CD28 Y218, the CAR was enriched through immunoprecipitation. D. Left Panel. Representative Western blot showing the phosphorylation of CD28 Y218, Zap70 Y319, PLCγ Y783, VAV1 Y174 in PSCA-specific CAR-T cells, following stimulation with HPAC WT or HPAC PSCA-KO cells. Right Panel. Phosphorylation intensity quantified by densitometry (representative plot). CD28 pY218, ZAP70 pY319, PLCγ pY783 and VAV1 pY174 normalized with respect to total CAR (CD3ζ), total ZAP70, total PLCγ and total VAV1 respectively. Untransduced cells (UT) were included as a negative control of immunoprecipitation. E. T cells were isolated from PBMCs and stimulated using CD3/CD28 T -activator Dynabeads®. CD28 was then enriched through immunoprecipitation for further analysis. Left Panel. Representative Western blot showing the phosphorylation of endogenous CD28 Y218 at the indicated time points after stimulation. Right Panel. Phosphorylation intensity quantified by densitometry. CD28 pY218 was normalized with respect to total CD28.
    Cd3 Cd28 T Activator Dynabeads, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd3+cd28+dynabeads/buffer+factor+foxp3+set+staining+transcription/bio_rxiv__64898__2026__01__28__701378-263-6-10
    Average 86 stars, based on 1 article reviews
    cd3 cd28 t activator dynabeads - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    a , Activated T cells were treated with either AAV6 or AAV-hT7 carrying a GFP transcript for transient expression. The cells were cultured in either serum free media (SF) or media supplemented with 10% fetal bovine serum (FBS) or human serum (HS) and GFP expression was measured by flow cytometry. Plotted values are GFP + cells relative to the SF value in each MOI condition in order to highlight changes in transduction efficiency when serum is present. Results are the mean ± SEM from three donors (n = 3). Significance was assessed using two-way ANOVA and Dunnett’s multiple comparisons test. b , Activated T cells were treated with either AAV6 or AAV-hT7 carrying a GFP transcript for transient expression at three different MOI. The cells were cultured in either serum free media. These values are used to calculate the relative GFP expression in (Fig. ). Results are the mean from two donors (n = 2). c , Activated T cells from three donors were electroporated with an RNP targeting the TRAC locus and treated with either AAV6 or AAV-hT7 carrying an HDR template to knock in a CAR at TRAC . The cells were cultured in either serum free media. These values are used to calculate the relative GFP expression in (Fig. ). Results are the mean ± SEM from three donors (n = 3). Significance was assessed using multiple two-tailed unpaired t -tests and the Holm-Šidák multiple comparisons test. d , TRAC -CAR-T cells expressing a 1928z-1XX were generated with a combination of EDV and AAV and functionally validated. TRAC -CAR-T cells were co-culture NALM6 cells at three effector cells to tumour cell ratios (E:T) for 24 h. Cytotoxicity was calculated by a luminescence read-out. Results are the mean ± SEM from four technical replicates (n = 4). e , Schematic of a genome-wide knockout screen to identify genes associated with AAV-hT7 uptake and processing in primary T cells. T cells were isolated from PBMCs, activated with CD3/CD28 beads, and transduced with the lentiviral sgRNA library, followed by Cas9 electroporation (SLICE approach). 3 days later, T cells were re-activated for 48 h and transduced with AAV6 or AAV-hT7 expressing GFP. At 48 h after AAV-hT7 transduction cells were sorted into four bins based on GFP expression. Genomic DNA was extracted from cells in each bin, and amplicon libraries were prepared and sequenced to determine sgRNA enrichment. f , g , Volcano plot displaying genome-wide KO screen results for AAV6 ( f) and AAV-hT7 ( g ), p-values determined using MAGeCK RRA one-sided tests and methods. h , PBMC-humanized were injected with either AAV6 (n = 6) or AAV-hT7 (n = 6) carrying a ss-CAG-GFP cargo, or PBS (n = 3). DNA was isolated from different organs harvested one week after injection. Viral genomes were quantified through qPCR and normalized by the DNA input. Results are the mean ± SEM.

    Journal: Nature

    Article Title: In vivo site-specific engineering to reprogram T cells

    doi: 10.1038/s41586-026-10235-x

    Figure Lengend Snippet: a , Activated T cells were treated with either AAV6 or AAV-hT7 carrying a GFP transcript for transient expression. The cells were cultured in either serum free media (SF) or media supplemented with 10% fetal bovine serum (FBS) or human serum (HS) and GFP expression was measured by flow cytometry. Plotted values are GFP + cells relative to the SF value in each MOI condition in order to highlight changes in transduction efficiency when serum is present. Results are the mean ± SEM from three donors (n = 3). Significance was assessed using two-way ANOVA and Dunnett’s multiple comparisons test. b , Activated T cells were treated with either AAV6 or AAV-hT7 carrying a GFP transcript for transient expression at three different MOI. The cells were cultured in either serum free media. These values are used to calculate the relative GFP expression in (Fig. ). Results are the mean from two donors (n = 2). c , Activated T cells from three donors were electroporated with an RNP targeting the TRAC locus and treated with either AAV6 or AAV-hT7 carrying an HDR template to knock in a CAR at TRAC . The cells were cultured in either serum free media. These values are used to calculate the relative GFP expression in (Fig. ). Results are the mean ± SEM from three donors (n = 3). Significance was assessed using multiple two-tailed unpaired t -tests and the Holm-Šidák multiple comparisons test. d , TRAC -CAR-T cells expressing a 1928z-1XX were generated with a combination of EDV and AAV and functionally validated. TRAC -CAR-T cells were co-culture NALM6 cells at three effector cells to tumour cell ratios (E:T) for 24 h. Cytotoxicity was calculated by a luminescence read-out. Results are the mean ± SEM from four technical replicates (n = 4). e , Schematic of a genome-wide knockout screen to identify genes associated with AAV-hT7 uptake and processing in primary T cells. T cells were isolated from PBMCs, activated with CD3/CD28 beads, and transduced with the lentiviral sgRNA library, followed by Cas9 electroporation (SLICE approach). 3 days later, T cells were re-activated for 48 h and transduced with AAV6 or AAV-hT7 expressing GFP. At 48 h after AAV-hT7 transduction cells were sorted into four bins based on GFP expression. Genomic DNA was extracted from cells in each bin, and amplicon libraries were prepared and sequenced to determine sgRNA enrichment. f , g , Volcano plot displaying genome-wide KO screen results for AAV6 ( f) and AAV-hT7 ( g ), p-values determined using MAGeCK RRA one-sided tests and methods. h , PBMC-humanized were injected with either AAV6 (n = 6) or AAV-hT7 (n = 6) carrying a ss-CAG-GFP cargo, or PBS (n = 3). DNA was isolated from different organs harvested one week after injection. Viral genomes were quantified through qPCR and normalized by the DNA input. Results are the mean ± SEM.

    Article Snippet: After thawing, T lymphocytes were purified using the EasySep Human T cell isolation kit (StemCell Technologies, 17951) and activated with Dynabeads Human T Expander CD3/CD28 at a 1:1 bead-to-cell ratio (Gibco, 11141D) in X-VIVO 15 medium (Lonza, BP04-744Q) supplemented with human serum (5%, Gemini Bioproducts, 100-512), IL-7 (5 ng ml −1 , Miltenyi Biotec, 130-095-367) and IL-15 (5 ng ml −1 , Miltenyi Biotec, 130-095-760) at a density of 1 × 10 6 cells per ml.

    Techniques: Expressing, Cell Culture, Flow Cytometry, Transduction, Knock-In, Two Tailed Test, Generated, Co-Culture Assay, Genome Wide, Knock-Out, Isolation, Electroporation, Amplification, Injection

    ( A and B ) CD25 + percentages from CB and AB naive CD4 + T cells after 96 hours of anti-CD3/CD28 stimulation under No Cytokine or IL-2 + TGF-β conditions. ( C – E ) Marker expression on CD25 + fraction by flow cytometry. ( F and G ) ELISA of cytokines in supernatant. ( H ) Allogeneic MLR measuring suppressive capacity of CB and AB No Cytokine and IL-2 + TGF-β-stimulated cells. ( I ) Allogeneic MLR assay for CD25 + versus CD25 neg iTreg-stimulated cells. ( J – L ) FOXP3 CNS2 methylation was assessed by bisulfide sequencing in CD4 + CD25 + CD127 lo cells from iTreg cultures and endogenous blood Tregs (CD4 + FOXP3 + CD25 + CD127 lo ). Two separate experiments were analyzed together with adjustment for batch effects. ( J ) Heatmap, ( K ) violin plot, and ( L ) graphs of CpG island methylation ratios. ( M ) FOXP3 stability assessed through 2 rounds of stimulation and rest. CD25 + and FOXP3 MFI on CD25 + cells after second rest. Data points represent individual donors. ( H and I ) N = 5/group. ( A – E ) One of 3 representative experiments. ( H ) One of 2 representative experiments. ( F , G , I , and M ) Performed once. ( J – L ) Combined data from 2 experiments. ( B – G and M ) Two-way ANOVA with multiple comparisons used. ( I ) One-way ANOVA with multiple comparisons used. ( L ) Linear mixed model (included batch correction). * P ≤ 0.05, ** P ≤ 0.02, *** P ≤ 0.001, **** P < 0.0001. Horizontal bars and column heights in panels B – G and M depict mean values. In H and I , mean value plus standard deviation is shown.

    Journal: The Journal of Clinical Investigation

    Article Title: CD38 expression by neonatal human naive CD4 + T cells shapes their distinct metabolic and tolerogenic properties

    doi: 10.1172/JCI200062

    Figure Lengend Snippet: ( A and B ) CD25 + percentages from CB and AB naive CD4 + T cells after 96 hours of anti-CD3/CD28 stimulation under No Cytokine or IL-2 + TGF-β conditions. ( C – E ) Marker expression on CD25 + fraction by flow cytometry. ( F and G ) ELISA of cytokines in supernatant. ( H ) Allogeneic MLR measuring suppressive capacity of CB and AB No Cytokine and IL-2 + TGF-β-stimulated cells. ( I ) Allogeneic MLR assay for CD25 + versus CD25 neg iTreg-stimulated cells. ( J – L ) FOXP3 CNS2 methylation was assessed by bisulfide sequencing in CD4 + CD25 + CD127 lo cells from iTreg cultures and endogenous blood Tregs (CD4 + FOXP3 + CD25 + CD127 lo ). Two separate experiments were analyzed together with adjustment for batch effects. ( J ) Heatmap, ( K ) violin plot, and ( L ) graphs of CpG island methylation ratios. ( M ) FOXP3 stability assessed through 2 rounds of stimulation and rest. CD25 + and FOXP3 MFI on CD25 + cells after second rest. Data points represent individual donors. ( H and I ) N = 5/group. ( A – E ) One of 3 representative experiments. ( H ) One of 2 representative experiments. ( F , G , I , and M ) Performed once. ( J – L ) Combined data from 2 experiments. ( B – G and M ) Two-way ANOVA with multiple comparisons used. ( I ) One-way ANOVA with multiple comparisons used. ( L ) Linear mixed model (included batch correction). * P ≤ 0.05, ** P ≤ 0.02, *** P ≤ 0.001, **** P < 0.0001. Horizontal bars and column heights in panels B – G and M depict mean values. In H and I , mean value plus standard deviation is shown.

    Article Snippet: In , other protocols for cell activation were used: Human T-Activator CD3/CD28 Dynabeads and plate-coating with anti-CD3/CD28 antibodies (UCSF Antibody Core clone: OKT3 2 μg/mL; Miltenyi Biotec 130-093-375, clone: 15E8, 4 μg/mL) overnight at 4°C or for 4 hours at 37°C.

    Techniques: Marker, Expressing, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Mlr Assay, Methylation, Sequencing, Standard Deviation

    A. Schematic representation of the CAR construct used in this study: a second-generation CAR receptor containing a CD28 hinge and transmembrane domain, a CD28 costimulatory domain, and CD3ζ signaling domain. B. Schematic representation of the protocol used to manufacture CAR-T cells. Healthy donor-derived PBMCs were activated using an anti-CD3 antibody. After 48h, expanded T cells were transduced with a retroviral vector to induce expression of the CAR. Transduction efficiency was assessed 5-7 days after transduction and cells were used for functional analysis between 7-14 days after transduction. C. Schematic representation of the protocol used to detect phosphorylation in CAR-T cells. CAR-T cells were cocultured with PSCA-expressing HPAC (HPAC WT ) or PSCA-deficient HPAC (HPAC PSCA-KO ) tumor cells for 1, 10, 30 and 60 minutes, followed by protein extraction. For cytoplasmic proteins (ZAP70, PLCγ, VAV1), phosphorylation was detected in the whole cell extract (WCE). For detection of phosphorylated CD28 Y218, the CAR was enriched through immunoprecipitation. D. Left Panel. Representative Western blot showing the phosphorylation of CD28 Y218, Zap70 Y319, PLCγ Y783, VAV1 Y174 in PSCA-specific CAR-T cells, following stimulation with HPAC WT or HPAC PSCA-KO cells. Right Panel. Phosphorylation intensity quantified by densitometry (representative plot). CD28 pY218, ZAP70 pY319, PLCγ pY783 and VAV1 pY174 normalized with respect to total CAR (CD3ζ), total ZAP70, total PLCγ and total VAV1 respectively. Untransduced cells (UT) were included as a negative control of immunoprecipitation. E. T cells were isolated from PBMCs and stimulated using CD3/CD28 T -activator Dynabeads®. CD28 was then enriched through immunoprecipitation for further analysis. Left Panel. Representative Western blot showing the phosphorylation of endogenous CD28 Y218 at the indicated time points after stimulation. Right Panel. Phosphorylation intensity quantified by densitometry. CD28 pY218 was normalized with respect to total CD28.

    Journal: bioRxiv

    Article Title: C-terminus CD28 phosphorylation (Y218) modulates IL-2 secretion and antitumor effect of CAR-T cells

    doi: 10.64898/2026.01.28.701378

    Figure Lengend Snippet: A. Schematic representation of the CAR construct used in this study: a second-generation CAR receptor containing a CD28 hinge and transmembrane domain, a CD28 costimulatory domain, and CD3ζ signaling domain. B. Schematic representation of the protocol used to manufacture CAR-T cells. Healthy donor-derived PBMCs were activated using an anti-CD3 antibody. After 48h, expanded T cells were transduced with a retroviral vector to induce expression of the CAR. Transduction efficiency was assessed 5-7 days after transduction and cells were used for functional analysis between 7-14 days after transduction. C. Schematic representation of the protocol used to detect phosphorylation in CAR-T cells. CAR-T cells were cocultured with PSCA-expressing HPAC (HPAC WT ) or PSCA-deficient HPAC (HPAC PSCA-KO ) tumor cells for 1, 10, 30 and 60 minutes, followed by protein extraction. For cytoplasmic proteins (ZAP70, PLCγ, VAV1), phosphorylation was detected in the whole cell extract (WCE). For detection of phosphorylated CD28 Y218, the CAR was enriched through immunoprecipitation. D. Left Panel. Representative Western blot showing the phosphorylation of CD28 Y218, Zap70 Y319, PLCγ Y783, VAV1 Y174 in PSCA-specific CAR-T cells, following stimulation with HPAC WT or HPAC PSCA-KO cells. Right Panel. Phosphorylation intensity quantified by densitometry (representative plot). CD28 pY218, ZAP70 pY319, PLCγ pY783 and VAV1 pY174 normalized with respect to total CAR (CD3ζ), total ZAP70, total PLCγ and total VAV1 respectively. Untransduced cells (UT) were included as a negative control of immunoprecipitation. E. T cells were isolated from PBMCs and stimulated using CD3/CD28 T -activator Dynabeads®. CD28 was then enriched through immunoprecipitation for further analysis. Left Panel. Representative Western blot showing the phosphorylation of endogenous CD28 Y218 at the indicated time points after stimulation. Right Panel. Phosphorylation intensity quantified by densitometry. CD28 pY218 was normalized with respect to total CD28.

    Article Snippet: T cells were then activated using CD3/CD28 T -activator Dynabeads® (Fisher Scientific, 11-131-D) at a 1:1 ratio.

    Techniques: Construct, Derivative Assay, Transduction, Retroviral, Plasmid Preparation, Expressing, Functional Assay, Phospho-proteomics, Protein Extraction, Immunoprecipitation, Western Blot, Negative Control, Isolation